The URL can be used to link to this page

Home My WebLink AboutOrdinance 4176 FILED FOR RECORD ' 99 IRG 18 AM 8 05 WASHINGTON CO AR K . HARNESS ORDINANCE NO. 4176 AN ORDINANCE CONFIRMING THE ANNEXATION TO THE CITY OF FAYETTEVILLE, ARKANSAS, OF CERTAIN PROPERTY OWNED BY KAREN HANNA AS REQUESTED IN RZA99- 1 . BE IT ORDAINED BY THE CITY COUNCIL OF THE CITY OF FAYETTEVILLE, ARKANSAS: Section 1 . That the City Council hereby confirms the annexation to the City of Fayetteville, Arkansas, of the following described property: See Exhibit "A" attached hereto and made a part hereof. Section2. That the above-described property is hereby assigned to Ward No. —I E"AS9ED AND APPROVED this _I day ofAug us , 1999. A&V41v APPROVED: d . Fred Hanna, Mayor V [ Q ATTEST: By Azi Heather Woodruff, City Merk t 990' 4708 Ordinance 4176 EXHIBIT "A" Part of the Northeast Quarter (NEI/4) of the Southeast Quarter (SE1/4) of Section 34, Township 16 North, Range 30 West of the Fifth Principal Meridian, Washington County, Arkansas, being more particularly described as follows, to- wit: Beginning at the Northeast Comer of said Northeast Quarter (NE1/4) of the Southeast Quarter (SE 1/4); thence S 1 °08' 14", E 679.22 feet to the center line of a county road; thence following said centerline, N 64°04'20", W388.70 feet; thence leaving said centerline, N 1 °40' 11 ", E 502.38 feet; thence N 88045'32", E 321 .54 feet to the point of beginning and containing 4.54 acres, more or less and subject to that portion which lies in the county road on the south side and to a 40 foot easement on the east side. 99174709 d� t� PiAv� wNu d#hereh`r �tN1ut,+Hut 1�gton °was C,d IOT ecsorndav�Wil �ccordsr farhia In-tNM3nl d tha ¢- . catUTica:e �etuN th,¢i tsd h,.con eer nent zndadtn¢roon- attico p¢ i:`tth tno GC'dno•;7 P Bo o'. 1nd'.c t MY recotd¢dln Ftcoord EnaA and F 1 h¢�'a hcreuntod¢0 indi- te WH -Fl , GOuP O0 %ho lNwlaflz dihee: lai hr'nd anlicad . n F:.,,matea N!a+¢ FlocordN F ` FAYETTEVILLE THE CITY OF FAYETTEVILLE, ARKANSAS 113 W. Mountain St. Fayetteville, AR 72701 Telephone: (501 ) 575-8264 PLANNING DIVISION CORRESPONDENCE TO: Fayetteville Planning Commission Members THRU: Tim Conklin, City Planner FROM: Brent Vinson, Associate Planner DATE: July 12, 1999 RZA 99-1.00: Annexation (Hanna, pp 759) was submitted by John Burrow on behalf of Karen Hanna for property located at 3686 Wilson Hollow Road. The property is in the planning growth area and contains approximately 4.54 acres. The request is to annex the subject property into the City of Fayetteville. RECOMMENDED MOTION: Staff recommends approval of the requested annexation based on the findings included as part of this report. PLANNING COMMISSION ACTION: YES Required Approved Denied Date: July 12, 1999 Comments: CITY COUNCIL ACTION: YES Required Approved Denied Date: Planning Commission Meeting July 12, 1999 RZA 99- 1 Hanna Page 2. l BACKGROUND : The applicant requests the annexation of her property to make available water and sewer services from the City of Fayetteville. No other construction or improvements to the property are contemplated. On the June 11 , 1999, the Washington County Judge confirmed the Order of Annexation for the property to be annexed into the City of Fayetteville. The property is located approximately two miles east of Drake Field and two miles north of Lake Wilson. The property is on Wilson Hollow Road which is unpaved. The applicant currently resides at the property and is the owner of 2.36 acres inside of the city limits just west of the subject property and of 10.53 acres outside the city limits south of the subject property. Property annexed into the city is automatically zoned A- 1 . The property contains 4.54 acres and with this annexation would meet the two acre minimum lot requirement with 388 .70' of frontage (200' of frontage is required under the A- 1 zoning.) ADJACENT LAND USE AND ZONING: North : Single family and undeveloped land (outside the city limits) South: Undeveloped land (outside the city limits) East: Single family (outside the city limits) . West: Single family and undeveloped land, R- 1 and A- 1 INFRASTRUCTURE: Streets: Wilson Hollow Road (unpaved) is a residential street. Water: There is a 2- 1/4" waterline along Wilson Hollow Road. Sewer: There is an no existing sewer line along Wilson Hollow Road or City Lake Road to the west. LAND USE PLAN: The General Plan 2020 shows this area as Residential . §161.03 DISTRICT A-1 AGRICULTURAL. A. Purposes. The regulations of the Agricultural District are designed to protect agricultural land until an orderly transition to urban development has been accomplished; prevent wasteful scattering of development in rural areas; obtain economy of public funds in the Planning Commission Meeting July 12, 1999 RZA 99-1 Hanna Page 2.2 providing of public improvements and services of orderly growth; conserve the tax base; prevent unsightly development, increase scenic attractiveness; and conserve open space. B. Uses. 1. Permitted Uses. Unit 1 City-Wide Uses by Right Unit 3 Public Protection and Utility Facilities Unit 6 Agriculture Unit 7 Animal Husbandry Unit 8 Single-Family and Two-Family Dwellings 2. Uses Permissible on App eal to the Planning Commission. Unit 2 City-Wide Uses by Conditional Use Permit Unit 4 Cultural and Recreational Facilities Unit 20 Commercial Recreation; Large Sites C. Bulk and Area Regulations. Lot Width Minimum 200 ft. Lot Area Minimum: Residential 2 acre Nonresidential 2 acre Lot Area Per Dwelling Unit 2 acre D. Yard Requirements (feet). FRONT SIDE REAR YARD YARD YARD 35 20 35 E. Height Requirements. There shall be no maximum height limits in the A- 1 District, provided, however, that any building which exceeds the height of 15 feet shall be setback from any boundary line of any residential district a distance of 1 .0 foot for each foot of height in excess of 15 feet. Such setbacks shall be measured from the required yard lines. Planning Commission Meeting July 12, 1999 RZA 99-1 Hanna Page 2.3 Willi.*., �l�b 60( M cvcrser ' �� 7(O State of Arkansas n SECRETARY OF STATE gRKA�Sa Sharon Priest SECRErAM OF SPATE January 25, 2001 The Honorable Marilyn Edwards Washington County Clerk 280 North College, Suite 300 Fayetteville, AR 72701 Dear Ms Edwards: The Following Information has been recorded and filed in the Office of the Secretary of State: Date: 01 /23/2001 County: Washington City: Fayetteville Annexation: Ordinance No. - 4176 Co. Order No. 99- 3 Plat - X- -Karen Hanna Annexation Election - Island - Incorporation: Ordinance No. Co. Order No. Plat - Election - Census Information 1st Class City 2nd Class City - Incorporated Town - I have forwarded this information to the Arkansas Municipal League. If you have any further questions please do not hesitate to contact me at 1 -800-482- 1127 or 682-3451 . Sincerely, ` Tena Arnold Election Services Representative State Capitol Little Rock. Arkansas 72201 -1094 (501 ) 682-1010 l FILED IN THE COUNTY OF WASHINGTON COUNTY, ARKWkil Rel 9 06 IN THE MATTER OF ANNEXATION OF MARILYN ED ;'/A. , DS CERTAIN TERRITORY TO THE CITY OF GO• $ PROBATE CLERK FAYETTEVILLE, WASHINGTON COUNTY, WASFIINGTON CO. ARK . ARKANSAS, A MUNICIPAL CORPORATION NO. CC 99-3 CONFIRMATION OF ANNEXATION On this l 1 "' day of June, 1999, this Court considers its Order of Annexation dated the 11th day of May, 1999, wherein certain property was annexed to the City of Fayetteville, Washington County, Arkansas. Said property is more particularly described as follows, to-wit: Part of the Northeast Quarter (NE1/4) of the Southeast Quarter (SEI/4) of Section 34, Township 16 North, Range 30 West of the Fifth Principal Meridian, Washington County, Arkansas, being more particularly described as follows, to- wit: Beginning at the Northeast Corner of said Northeast Quarter (NEI/4) of the Southeast Quarter (SEI/4); thence S 1°08 ' 14", E 679.22 feet to the center line of a county road; thence following said centerline, N 64°04'20", W 388 . 70 feet; thence leaving said centerline, N 1°40' 11 ", E 502.38 feet; thence N 88°45 ' 32", E 321 . 54 feet to the point of beginning and containing 4. 54 acres, more or less and subject to that portion which lies in the county road on the south side and to a 40 foot easement on the east side. This Court finds that its Order entered on the 11 'h day of May, 1999, was recorded by the County Clerk on the 11 'h day of May, 1999, more than thirty day hence, and that there have been no objections filed to such order. THEREFORE, the Order of this Court dated the I I'h day of May, 1999, annexing the above described property to the -City of Fayetteville, Washington County, Arkansas, and all proceedings before this Court relating thereto, are hereby confirmed. e Hun on, County Judge Planning Commission Meeting July 12, 1999 RZA 99-1 Hanna Page 2.4 c� > os �o IN THE COUNTY COURT OF WASHINGTON COUNTY, ARKAN!rA � oC7 Z /� o m t? IN THE MATTER OF ANNEXATION OF ? a CERTAIN TERRITORY TO THE CITY OF FAYETTEVILLE, WASHINGTON COUNTY, > m v cD ARKANSAS, A MUNICIPAL CORPORATION NO. CC 99-3 ;:a N N ORDER OF ANNEXATION Now on this �day of 1999, comes on before the Court the matter of annexation of certain lands to the City of Fayetteville, Washington County, Arkansas, described as follows, to-wit: Part of the Northeast Quarter (NEI /4) of the Southeast Quarter (SEI/4) of Section 34, Township 16 North, Range 30 West of the Fifth Principal Meridian, Washington County, Arkansas, being more particularly described as follows, to- wit: Beginning at the Northeast Corner of said Northeast Quarter (NEI/4) of the Southeast Quarter (SEI /4); thence S 1 °08 ' 14", E 679.22 feet to the center line of a county road; thence following said centerline, N 64°04'20", W 388 .70 feet; thence leaving said centerline, N 1°40' 11", E 502.38 feet; thence N 88045132 , E 321 .54 feet to the point of beginning and containing 4. 54 acres, more or less and subject to that portion which lies in the county road on the south side and to a 40 foot easement on the east side. From the evidence presented by the petitioner, Karen Hanna, the Court finds as follows: 1 . That petitioner has petitioned this Court to annex the above described property into the City of Fayetteville, Washington County, Arkansas, and have published notice of the hearing as required by law and no one has appeared against the petition on the date and time set for the hearing. - -- 2. That all the lands proposed to be annexed into Fayetteville, Washington County, Arkansas, are within the Fayetteville School District, and further the lands are contiguous to property already situated in Fayetteville, Washington County, Arkansas. Planning Commission Meeting July 12, 1999 RZA 99-1 Hanna Page 2.5 3 . That the property which is legally described in the petition has been accurately described and an accurate map thereof has been made and filed and the prayer of the petitioner is right and proper. 4. The Court therefore determines that an Order of Annexation is proper. IT IS THEREFORE, CONSIDERED, ORDERED, ADJUDGED AND DECREED that the above described tract of land be, and hereby is annexed to and made a part of the City of Fayetteville, Washington County, Arkansas, subject to approval by the City Council for the City of Fayetteville, Arkansas. o ty Ju*e Planning Commission Meeting July 12, 1999 RZA 99- 1 Hanna Page 2.6 PLAT— OF—SURVEY S 8845 32 W 31 NE COR. SBa^a 3' 32' W NEV4 SE 1/4 3 250. 0 34 - I6 - 30 P.O.a. W m 07 v ¢ J u� - 00 ACRES M O by iV1ne%� O Q Svrr4y n[r. tRON V) Ln 0 OR. Z. PC. 942 19. 67• %y Z Sl St `269 sg, s• Oy , + N • `" F\ s470 3e9 AO 47 Lfi 4004 . U3 20.. C) F 30' m 0 3 10. 53 v ACRES � 30' SCALE . IN FEET -r vp a) I O W 200 100 0 200 Z O ' � O V) EXHIBIT A SE COR. NE 1/4 SE 1/4 S 8845' 32- W 571. 54' / 34 - 16 - 30 I-� ar�na Proper+y • SURVEY DESCRIPTION fanning Commission Meeting July 12, / 999 RZA 99- 1 Hanna SEE ATTACHED SHEET Page 2. 7 RZA99 - 1 . 00 - Hanna - One Mile Radius W O AA Q J W h� qL� CRY LkM R-1 N1 A-1 51y.�F�a 4 - Gpi 1400 0 1400 Feet N E Planning Commission Meeting July 12, 1999 RZI 99- 1 Hanna S Page 2.8 RZA99-1.00 - Hanna - Close Up City Limits O R-1 0 A_1 o /� o �,7 Nyp<<o ❑ w jJ 300 0 300 Feet Planning Commission Meeting July 12, 1999 RZA 99-1 Hanna S Page 2.9 Transcript of Planning Commission Meeting July 12, 1999 Page 3 RZA 99-1: ANNEXATION HANNA, PP759 This item was submitted by John Burrow on behalf of Karen Hanna for property located at 3686 Wilson Hollow Road. The property is in the planning growth area and contains approximately 4.54 acres. The request is to annex the subject property into the City of Fayetteville. Staff recommends approval of the requested annexation. John Burrow was present on behalf of the request. Committee Discussion Johnson: The request is to annex into the City for water and sewer service in the future and also for trash pickup. The maps start on page 2.7. Does staff have anything additional to what we had in our packet handed out at agenda session? Conklin: There is no additional information. Johnson: Okay, Tim. Mr. Burrow, tell us who you are for the record and tell us what you have to add or subtract from our packet if you will. Burrow: I'm here on behalf of and with Karen Hanna. We would --first, I'd like to thank the staff for the care and consideration they gave us in preparation and discussion with Tim in this petition and to say on behalf of the City of Fayetteville, we are proud to have you all working for us. It's a simple request for the annexation of this land into the City of Fayetteville. There is absolutely no change in the existing use contemplated. Ms. Hanna simply wants to access city water and solid waste disposal services. That's basically how I would respond to your inquiry. I think this petition is pretty complete. Johnson: Thank you, Mr. Burrow. Are there initial questions of the applicant? Seeing none right off the bat, let me ask whether there is anyone in the audience who would address us on this particular annexation request? Public Comment None Further Discussion Johnson: Are there questions, comments or motions? Miif K1l ;JED RECEIVED STATE OF ARKANSAS DEC 281999 County of Washington } ss. ACCTG. DEPT I, JEFF JEFFUS, hereby certify that I am the publisher of THE NORTHWEST ARKANSAS TIMES, a daily newspaper having a second class mailing privilege, and being not less than tour pages of five columns each, published at a fixed place of business and at fixed (daily) intervals continuously in the City of Fayetteville, County of Washington, Arkansas for more than a period of twelve months, circulated and distributed from an established place of business to subscribers and readers generally of all classes in the City and County for a definite price for each copy, or a fixed price per annum, which price was fixed at what is considered the value of the publication, based upon the news value and service value it contains, that at least fifty percent of the subscribers thereto have paid for their subscriptions to the newspaper or its agents or through recognized news dealers over a period of at least six months and that the said newspaper publishes an average of more than forty percent news matter. I further certify that the legal notice attached in the matter of ORDINANCE NO.4176 /' I/y/}/, 1%`d ^� 49 AN ORDINANCE CONFIRM- (U' (�rA7 /((J '/ L ING THE. ANNEXATION TO / THE CITY OF FAYETTEVILLE, ARKANSAS, OF CERTAIN was published in the regular daily issue of said newspaper for PROPERTY OWNED BY KA- consecutive insertions as follows: REN HANNA AS REQUESTED IN RZA99-1. BE IT ORDAINED BY THE The first insertion on the / day of 19 CITY. COUNCIL OF. THE CITY OF FAYETTEVILLE, ARKAN- SASthe second insertion on the day of 19 Section 1. That the City Council hereby confirms the annexation the third insertion on the day of 19 to the City of Fayetteville, Ar- kansas, of the following descri- bed property: the fourth insertion on the ay of 19 See Exhibit "A% attached hereto "? J, and made a part hereof. Section 2. That the above de- s er/General Manager scribed property is hereby as- signed to Ward No. 1. Sworn to and su7�ed before on this da PASSED AND APPROVED this 3rdday of August, 1999. to and s u bet ore me 19 APPROVED: By: Fred Hanna, Mayor ATTEST: +•� • 1. L..�. : By: Heather Woodruff, City >, - Nota Public Clerk )` Notary Public.Stetool.+tkaDsas ry My Commission Expires: Washington County )` My CORVnl5ston nxpue> cccccuccccccaacccccacc<cccccCCC Fees for Printing.......................................................$ Costof Proof............................................................. $ Total......................................................................... $ RECEIVED STAFF REVIEW FORM JUL 2 0 1999 X_ Agenda Request Contract Review CITY OF FAYETTEVILLE Grant Review CITY CLERK'S OFFICE For the Fayetteville City Council meeting of August 3, 1999. FROM: Tim Conklin Planning Public Works Division Department ACTION REQUESTED: To approve an ordinance for annexation request RZA99-1 submitted by John Burrow on behalf of Karen Hanna for property located at 3686 Wilson Hollow Road. The property is in the planning growth area and contains approximately 4.54 acres. The request is to annex the subject property into the City of Fayetteville. COST TO CITY: Cost of this request Category/Project Budget Category/Project Name Account Number Project Number Funds used to date Remaining balance Program Name Fund BUDGET REVIEW: Budgeted Item Budget Adjustment Attached Services Director Budget Coordinator Administrative CONTRACT/GRANT/LEASE REVIEW: GRANTING AGENCY: AccoQit' g Sanager Da e ADA Coordinator Date Ci At ney Date Internal Auditor Date Purchasing Officer Date STAFF RECOMMENDATION: Staff recommended approval and Planning Commission voted unanimous approval to forward the request to the City Council. _ A" Cross Reference Date a e New Item: Yes No i a4t Prev Ord/Res#: ate Orig Contract Date: FAYETTEVILLE THE CITY OF FAYETTEVIEEE, ARKANSAS DEPARTMENTAL CORRESPONDENCE To: Tim Conklin, City Planning From: Theresa Johnson, Deputy City Clerk Date: August 5, 1999 Re: Ordinance 4176, RZA 99-1 Attached please find a copy of Ordinance 4176 and its back-up material. cc: Tony Webb, Planning Sharon McCourt, Planning Clyde Randall, Engineering Ed Connell, Land Agent JrnkF, Dom. �Ss. 3,n Tvkw't5TNt, ` s l